فيروس كورونا الجديد-covid-19 - منتديات بوابة الونشريس


اضافة رد

قديم 2020-05-30, 07:35 PM

مستشار المنتديات
 الصورة الرمزية nadia
تاريخ التسجيل: Jun 2009
الموقع: الجزائر
المشاركات: 11,350
معدل تقييم المستوى: 10
nadia will become famous soon enough
B18 فيروس كورونا الجديد-covid-19

كل ما يعرفه العلماء حتي اليوم عن جينوم الفيروس و بروتيناته و وظائفها

نشرت جريدة النيويورك تايمز مقالاً تفصيلياً مميزاً عن المكونات الجزيئية لفيروس كورونا الجديد SARS-Corona-2 مبينة تفاصيل دقيقة لكل جزء من الاجزاؤه الهامة. فيما يلي ترجمة للمقالة مع توضيحات لبعض الاجزاء بمصطلحات بسيطة لتقريبها لغير المتخصصين.

عام 1977 وصف عالما الأحياء جين ميدوير و بيتر ميدوير الفيروس بانه "حزمة من الاخبار السيئة ملفوفة في بروتين".
في يناير 2020 فكك العلماء احدي اسوأ الشفرات, جينوم فيروس سارس-كورونا2 المسبب لمرض كوفيد-19 العينة جاءت من رجل في الـ41 من عمره و يعمل في سوق المأكولات البحرية في مدينة ووهان الصينية, اول مكان ظهر فيه بؤرة للمرض. يتسابق العلماء حالياً علي فهم هذه التركيبة الفيروسية و التي تعطي املاً في إنتاج ادوية و امصال او ادوات اخري تفيد في مواجهة الجائحة الحالية.

خيط من الحمض النووي الريبوزي RNA
يحتاج الفيروس الي احتلال خلية حية حتي يستطيع التضاعف و الانتشار. عندما يجد فيروس كورونا خلية مناسبة فانه يحقن داخلها خيط من الحمض النووي الريبوزي RNA يحتوي جينوم الفيروس بالكامل.

جينوم الفيروس الجديد طولة اقل من 30 الف "حرف" (الجينوم البشري 3 مليار "حرف"). استطاع العلماء حتي الان التعرف فيه علي جينات مسؤولة عن انتاج 29 بروتين و التي تقوم بمجموعة من العمليات مثل تضاعف الفيروس و تثبيط رد الفعل المناعي للجسم.

توضيح 1
حرف يقصد به "نيوكليوتيدة" او القواعد النووية و هي وحدة تركيب الجينوم. يوجد 4 انواع من النيوكليوتيدات في الجينوم المكون من DNA و يرمز لها بـA,G,C,T بينما الجينوم المكون من RNA (مثل جينوم هذا الفيروس) فيتكون من A,C,G,U.

اول تتابع من الاحرف او القواعد النووية يبدو كالتالي:
auuaaagguuuauaccuucccagguaacaaaccaaccaacuuucgaucuc uuguagaucuguucucuaaacgaacuuuaaaaucuguguggcugucacuc ggcugcaugcuuagugcacucacgcaguauaauuaauaacuaauuacugu cguugacaggacacgaguaacucgucuaucuucugcaggcugcuuacggu uucguccguguugcagccgaucaucagcacaucuagguuucguccgggug ugaccgaaagguaag

و يقوم هذه التتابع بتسخير آليات خلية العائل و جعلها تبدأ في قراءة الشفرة الوراثية للفيروس و تترجمتها بروتينات.

فيما يلي نعرض جينوم الفيروس بالكامل و البروتينات التي ينتجها.

سلسلة من بروتينات ORF1ab
اول ما ينتجه الفيروس من بروتينات داخل الخلية المصابة هي سلسلة من 16 بروتين مرتبطين معاً. يعمل اثنان منهما كالمقص و يفصلان الروابط بين البروتينات المختلفة لتحريرهم لينطلقوا لأداء عملهم

ساهمت الابحاث السابقة علي افراد اخري من عائلة فيروسات كورونا في اعطاء العلماء فكرة عن وظائف بعض بروتينات فيروس كورونا الجديد. لكن بعض البروتينات الاخري مازالت وظيفتها غامضة كما يبدو البعض الاخر بدون وظيفة علي الإطلاق.

البروتين المخرب للخلية: NSP1
وظيفة هذا البروتين هي الإبطاء من وتيرة انتاج الخلية المصابة للبروتينات الخاصة بها. و يؤدي هذا التخريب اللي زيادة انتاج الخلية من بروتينات الفيروس و تقليل انتاجها للمضادات الفيروسية التي كان من الممكن ان توقف عمل الفيروس.

البروتين الغامض: NSP2
لم يستطع العلماء بعد التعرف علي وظيفة هذا البروتين. لكن بعض البروتينات التي يرتبط بها قد تعطي فكرة عما قد تكون وظيفته. اثنان من تلك البروتينات التي يرتبط بها تقوم بنقل الليسوسومات (فقاعات مليئة بالجزيئات) خلال الخلية.

بروتين القطع و ازالة العلامات: NSP3
البروتين NSP3 هو بروتين كبير يقوم بأداء وظيفتين. اولاً: تحرير البروتينات الفيروسية الاخري كي تقوم بأداء وظيفتها. ثانياً: تعديل/تحوير العديد من بروتينات الخلية المصابة.
في الطبيعي, تقوم الخلية السليمة بوضع علامات علي البروتينات القديمة تمهيداً لتدميرها. يقوم هذا البروتين بأزالة هذه العلامات مما يخل بسلامة الخلية و ربما يضعف من قدرتها علي مقاومة الفيروس.

البروتين صانع الفقاعات: NSP4
بالتعاون مع بروتينات اخري يقوم هذا البروتين بـبناء فقاعات مليئة بالسوائل داخل الخلية المصابة. يتم بناء اجزاء من الفيروسات الجديدة داخل هذه الفقاعات.

مقصات البروتين: NSP5
يقوم هذا البروتين بأغلب عمليات القطع التي تساعد باقي بروتينات NSP علي التحرر و القيام بوظائفها.

مُصَنِع الفقاعات: NSP6
يتعاون مع NSP3 و NSP4 لعمل مصنع لانتاج الفقاعات داخل الخلية.

البروتينات المساعدة في النسخ: NSP7, NSP8
سقوم هذان البروتينان بمساعدة البروتين NSP12 في تكوين نسخ كاملة من جينوم الفيروس و التي سوف ينتهي بها المقام في نسخ جديدة من الفيروس.

البروتين الداخل الي قلب الخلية: NSP9
يقوم هذا البروتين بإختراق قنوات دقيقة في نواة الخلية المصابة و التي تحتوي جينوم العائل. و يعتقد انه يؤثر علي حركة الجزيئات الخلوية خروجاً و دخولاً الي النواه. و لكن, لماذا يقوم بهذا؟ ليس واضحاً حتي الآن.

البروتين المُمَوِه للجينات: NSP10
تحتوي الخلايا البشرية علي مضادات للفيروسات و التي تبحث عن الـRNA الفيروسي و تقوم بتدميره. يقوم هذا البروتين, بالتعاون مع NSP16, بالتمويه علي الجينات الفيروسة لخداع الخلية فلا تقوم بمهاجتها.

آلة التصوير: NSP12
يقوم هذا البروتين بتجميع القواعد الوراثية لصنع نُسَخ من الجينوم. وجد العلماء ان عقار remdesivir و هو عاقر مضاد للفيروسات يتداخل مع عمل هذا البروتين في فيروسات كورونا الأخري و بالتالي يتم تجربته الآن علي فيروس كورونا الجديد.
تتابع اخر يسمي NSP11 يتراكب مع جزء من الـRNA الخاص بـNSP12 و لكن ليس من الواضح اذا كان هذا الجين الصغير يقوم بوظيفة ما, ام لا؟

بروتين تفكيك (حل عُقد) الـNSP13: RNA
عادة ما تكوت المادة الوراثية ملتوية و معقودة. يعتقد العلماء ان هذا البروتين يقوم بتفكيك هذا التعقد و جعلها متاحة للبروتينات الأخري لتقوم بقراءتها و نسخها.

بروتين المراجعة اللغوية: NSP14
عندما يقوم بروتين NPS12 بتكوين نسخة جديدة من جينوم الفيروس فأنه من الممكن ان يخطئ في بعض "الأحرف". يقوم هذا البروتين يإزالة هذه الاخطاء ليتم وضع الحروف الصحيحة.

بروتين التنظيف: NSP15
يعتقد العلماء ان هذا البرويتن يقوم بالتخلص من اي بقايا من الـRNA الخاص بالفيروس و بالتالي يتجنب إثارة دفاعات الخلية المصابة ضد الفيروس.

المزيد من التمويه: NSP16
يتعاون هذا البروتين مع البرويتن NSP10 لمساعدة جينات الفيروس في التخفي عن آليات المناعة في الخلية و التي تقوم بتقطيع المادة الوراثية للفيروس.

البروتينات الهيكلية
يحتوي الفيروس علي اربعة بروتينات هيكلية. و هذه البروتينات الهيكلية الأربعة هي التي تشكل الطبقة الخارجية من الفيروس و التي تحمي مادته الوراثية. و تساعد هذه البروتينات الهيكيلة ايضاً علي تجميع و اطلاق النسخ الجديدة من الفيروس.

جميع البروتينات السابق ذكرها تعد بروتينات وظيفية اي انها تقوم بوظائف داخلية تتمحور حول تكوين نسخ جديدة من مادته الوراثية و لا تدخل في تكوين هيكل البروتيني و غلاف الفيروس.

بروتين البروز (Spike): البروتين S
هو احد البروتينات الهيكلية الأربعة و يقوم بتكوين بروزات خارجية علي سطح الفيروس يتكون كلا منها من مجموعة من ***1635; نسخ من هذا البروتين. هذه البروز الشبيهة بالتاج هي التي اعطت لفيروسات كورونا اسمها (الفيروسات التاجية).
يعد هذا البروتين من اهم بروتينات الفيروس في احداث العدوي حيث يستطيع هذا البروز التعلق بمستقبل خاص يسمي ACE2 يوجد علي سطح بعض انواع الخلايا في المجري التنفسي و منها يبدأ الفيروس في الدخول اللي الخلية.
وجد العلماء ان الجين الخاص بهذا البروتين في فيروس كورونا الجديد يحتوي علي تتابع مكون من ***1633;***1634;قاعد RNA هو "ccucggcgggca" و يعد تتابع دخيل "طفرة". و تساعد هذه الطفرة في جعل هذا البروتين يرتبط بشدة بالخلية البشرية و هي خطوة هامة جداً في احداث الاصابة و تعد خطوة تطورية هامة مقارنة بالفيروسات الاخري من نفس العائلة و لتي تصيب الخفافيش و كائنات اخري.
يعكف العديد من الفرق العلمية الآن علي تصميم مصل يمنع الفيروس من الارتباط بالخلايا البشرية.

فنان الهرب: ORF3a
جينوم فيروس كورونا الجديد يقوم ايضاً بصناعة مجموعة بروتينات تسمي البروتينات المساعدة. تقوم هذه البروتينات بالمساعدة علي تغيير طبيعة البيئة داخل الخلية المصابة لتصبح اكثر ملائمة لتضاعف الفيروس.
بروتين ORF3a يقوم بصناعة فتحة في جدار الخلية المصابة ليجعل خروج الفيروسات الجديدة الي خارج الخلية اسهل.و هو ايضاً الذي يسبب الألتهاب في منطقة العدوي, و الذي يعد احد اسوأ اعراض كوفيد-***1633;***1641;.
جين ORF3b يتراكب مع تتابع ORF3a و لكن العلماء ليسوا متأكدين بعد من انه يتم ترجمته الي بروتين ام لا؟

بروتين الغلاف او المظروف: البروتين E
هو ثاني البروتينات الهيكلية و يساهم في بناء الفقاعة الزيتية للفيروس. و يعتقد ان لديه وظائف اخري تتم عند دخول الفيروس الي الخلية. وجد الباحثون انه يقوم بالسيطرة علي البروتينات التي تتحكم في عمل و توقّف جيناتنا و انه من الممكن ان تتغير انماط العمل/التوقف نتيجة لتأثير هذا البروتين.

بروتين الغشاء: البروتين M
البروتين الهيكلي الثالث و يلعب دوراً في تكوين الغلاف الخارجي للفيروس.

البروتين مانع الاشارات: ORF6
هو احد البروتينات المساعدة و وظيفته منع ارسال الأشارات التي ترسللها الخلية المصابة اللي جهاز المناعة. كما يوقف عمل بعض آاليات الخلية الدفاعية ضد الفيروسات, نفس الآليات التي تستهدف عن طريق فيروسات خطيرة اخري كفيروس شلل الاطفال و فيروس الانفلونزا.

البروتين محرر الفيروسات: ORF7a
بعد تكوين الفيروسات الجديد, تقوم الخلية بمحاولة عرقلة خروجهم منها عن طريق بروتينات تسمي Tetherin. يعتقد العلماء ان هذا البروتين يقوم بقطع امداد الخلية المصابة من بروتينات الـTetherin, مما يؤدي الي مساعدة اكبر عدد من الفيروسات الجديدة علي الهرب. بل وجد الباحثون ان هذا البروتين قد يدفع الخلية المصابة اللي الانتحار, و هو ما يساهم في الضرر الكبير الذي يسببه مرض كوفيد-***1633;***1641; للرئة.
جين ORF7 يتراكب مع تتابع ORF7a و لكن العلماء ليسوا متأكدين بعد من وجود وظيفة ما لهذا الجين؟

جميع الخلايا الحية يوجد بها آلية قتل ذاتية تسمي Appoptosis تستخدم في الطبيعة لقتل الخلية عند وصولها لسن معين او شعورها بخطر شديد نتيجة اصابة بكائن ممرض. تقوم الخلية بقتل نفسها ليموت معها الكائن الممرض. لكن يبدو هنا ان الفيروس يستطيع الوصول لهذه الآلية و تنشيطها لتعمل ضد الخلية.

بروتين غامض اخر: ORF8
احد البروتينات التي تنتج من الجينات الساعدة و يري العلماء ان هذا الجين مختلف بشدة في فيروس كورونا الجديد عن باقي فيروسات كورونا المعروفة. مازالت وظيفته غير متفق عليها بين العالماء.

بروتين الكبسولة النووية: البروتين N
البروتين الهيكلي الرابع و الذي يقوم بحماية المادة الوراثية للفيروس. تتحد اعداد كبيرة من هذا البروتين لتغلف الـRNA الخاص بالفيروس.
الجينات المنتجة للبروتينات المساعدة ORF9c و ORF9b يتراكب مع تتابع الـRNA لهذا الجين. يقول العلماء ان ORF9b يمنع عمل الانترفيرونات وهي احد اهم المركبات التي تستخدمها الخلية في الدفاع ضد الفيروسات. و ليس من الواضح حتي الان اذا كان ORF9c يستعمل ام لا؟

بروتين غامض ثالث: ORF10
الفيروسات القريبة جداً من فيروس كورونا الجديد لا تحتوي علي هذا الجين المساعد الصغير. و بالتالي فليس من الواضح حتي الآن وظيفة هذا الجين و اذا كان يترجم الي بروتينات ام لا.

خط النهاية
ينتهي جينوم فيروس كورونا الجديد بأمتداد من الـRNA وطيفته تعطيل آالية انتاج البروتين في الخلية. ثم ذيل من تتابع عديد الادينين "aaaaaaaaaaaaa".

caaucuuuaaucaguguguaacauuagggaggacuugaaagagccaccac auuuucaccgaggccacgcggaguacgaucgaguguacagugaacaaugc uagggagagcugccuauauggaagagcccuaauguguaaaauuaauuuua guagugcuauccccaugugauuuuaauagcuucuuaggagaaugacaaaa aaaaaaaaaaaaaaaaaaaaaaaaaaaaa

توقيع : nadia

مواقع النشر

فيروس كورونا الجديد-covid-19

يتصفح الموضوع حالياً : 1 (0 عضو و 1 ضيف)
أدوات الموضوع

ضوابط المشاركة
لا تستطيع إضافة مواضيع جديدة
لا تستطيع الرد على المواضيع
لا تستطيع إرفاق ملفات
لا تستطيع تعديل مشاركاتك

BB code متاحة
كود [IMG] متاحة
كود HTML معطلة

الساعة الآن 04:13 AM.